Skip to main content

Table 1 Sequences of the primers and PCR products size

From: Effects of a novel cyclic RGD peptidomimetic on cell proliferation, migration and angiogenic activity in human endothelial cells

Gene Ref. sequence Sequence Product size
αv NM_002210 Forward: actggcttaagagagggctgtg 110
Reverse: tgccttacaaaaatcgctga
β3 NM_000212 Forward: agacactcccacttggcatc 123
Reverse: tcctcaggaaaggtccaatg
β5 NM_002213 Forward: agcctatctccacgcacact 91
Reverse: cctcggagaaggaaacatca
GAPDH NM_001289746.1 Forward: caactgtgaggaggggagatt 97
Reverse: cagcaagagcacaagaggaag